grna target sequences Search Results


90
GenScript corporation grna sequences targeting cyclin t1
Screening effective <t>gRNA</t> target sites for <t>cyclin</t> <t>T1</t> editing: HeLa cells were transfected with pLentiCRISPR-gRNA-1, pLentiCRISPR-gRNA-2, or pLentiCRISPR-gRNA-3 using lipofectamine 2000 as described in methods Our previously reported lentiviral vector pHIV-7-GFP was transfected as control. , 8 days post-transfection, total protein was isolated and analyzed for cyclin T1 protein levels using western blot analyses. pLentiCRISPR-gRNA-2 demonstrates maximal cyclin T1 suppression (A). HIV-infected HeLa-CD4 cells were transfected with pLentiCRISPR-gRNA-1, pLentiCRISPR-gRNA-2, or pLentiCRISPR-gRNA-3. At designated time points, culture supernatants were collected and analyzed for HIV p24. All three gRNAs demonstrate HIV suppression, with pLentiCRISPR-gRNA-2 demonstrating maximal suppression at both time points (B). Cells were trypsinized, followed by trypsin neutralization buffer. Cells were washed to remove trypsin and resuspended in DMEM 10% FBS. The otal number of live cells and percentage of viability were determined by trypan blue staining as described in . Cyclin T1 knockdown does not affect the percentage of cell viability. However, we observed a statistically significant decline in the number of live cells with all pLentiCRISPR-gRNAs, including our most efficient pLentiCRISPR-gRNA-2 (C). n = mean ± SEM from 3 independent experiments. ∗, significant from control; S, significant from each other (p < 0.05).
Grna Sequences Targeting Cyclin T1, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pmc10192333-269-1-9?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
grna sequences targeting cyclin t1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation snx2 crispr grna plasmid (grna targeting sequence: 5′-tgatggcatgaatgcctata-3′)
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Snx2 Crispr Grna Plasmid (Grna Targeting Sequence: 5′ Tgatggcatgaatgcctata 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pmc06363445-221-21-32?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
snx2 crispr grna plasmid (grna targeting sequence: 5′-tgatggcatgaatgcctata-3′) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation reference mouse glut1 cdna
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Reference Mouse Glut1 Cdna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pmc10509671__BLOODA_ADV___2023___009967___mmc1-46-6-22?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
reference mouse glut1 cdna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
CustomArray Inc oligonucleotide pool encoding grna and target sequence
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
Oligonucleotide Pool Encoding Grna And Target Sequence, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/bio_rxiv__400341-163-17-15?v=CustomArray+Inc
Average 90 stars, based on 1 article reviews
oligonucleotide pool encoding grna and target sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Verlag GmbH grna-target sequence pairs
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
Grna Target Sequence Pairs, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/10__1002_slash_advs__201903562-205-12-3?v=Verlag+GmbH
Average 90 stars, based on 1 article reviews
grna-target sequence pairs - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
KU Leuven p58 backbone with 2 grna targeting sequence for pdc5
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
P58 Backbone With 2 Grna Targeting Sequence For Pdc5, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pmc09520875-22-0-16?v=KU+Leuven
Average 90 stars, based on 1 article reviews
p58 backbone with 2 grna targeting sequence for pdc5 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide rna (grna) sequences targeting the exon regions of the human il15ra gene
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
Guide Rna (Grna) Sequences Targeting The Exon Regions Of The Human Il15ra Gene, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pmc11986442-68-6-17?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences targeting the exon regions of the human il15ra gene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation grna sequence targeting mouse foxl1
High throughput measurement of repair outcomes. Constructs containing both a <t>gRNA</t> and its <t>target</t> <t>sequence</t> (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).
Grna Sequence Targeting Mouse Foxl1, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pm33197448-108-15-28?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
grna sequence targeting mouse foxl1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation hnf4a -targeting grna
a The sequence of the lentiviral gRNAHNF4A and its PAM site in blue. Above is the reference sequence of the <t>HNF4A</t> gene near the gRNA target site, as validated by Sanger sequencing in primary human hepatocytes expressing via lentivirus Cas9 and gRNAscr, with the TSS indicated by a black arrow and the reference protein sequence in red. CGs are bolded and underlined. Below is the dominant Sanger sequence profile of a primary human hepatocyte population expressing lentiviral Cas9 and gRNAHNF4A. This mutation and the resulting difference in the amino acid sequence, as well as the reference sequences at this location, are highlighted in yellow. b Two technical replicates each of the Sanger sequencing chromatograms from the primary human hepatocytes expressing dCas9 and gRNAscr (left) or dCas9 and gRNAHNF4A (right) at the targeted HNF4A locus. c Sanger sequencing results of 13 gRNAscr and 12 gRNAHNF4A DNA strands following bisulfite conversion from the cell populations in ( b ), demonstrating both the methylation levels and the variety of mutations induced by Cas9 in gHNF4A-treated cells. d Same as ( c ) except data expanded is expanded to a larger (>300 bp) region, and simplified such that only CpGs are shown, where blue squares indicate unmethylated CpGs, red squares indicate methylated CpGs, and white squares indicate missing information due to Cas9-induced deletions. CpGs are numbered in accordance with ( a ). e Bisulfite-sequencing data from ( d ) (center) as well as five CpGs immediately upstream (left) and seven CpGs immediately downstream (right), displayed as percent DNA methylation over all sequenced DNA strands in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) and as mean ± SD as it is summary data from one mutated cell line. Individual dots represent individual strands of DNA from this clonal cell line. f HNF4A expression in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) quantified by RT-qPCR and normalized to GAPDH expression, followed by normalization to average expression in gRNAscr cells, with a dashed line at 1 ( n = 6 independent clones, mean ± SD). * indicates statistically significant difference of P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, and ns not significant (Student’s t -test, two-sided, with Holm-Sidak correction if number of tests is greater than 3). Source data are provided as a Source Data file.
Hnf4a Targeting Grna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pmc08481236-449-1-18?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
hnf4a -targeting grna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Broad Institute Inc grna target sequence predictor tool
a The sequence of the lentiviral gRNAHNF4A and its PAM site in blue. Above is the reference sequence of the <t>HNF4A</t> gene near the gRNA target site, as validated by Sanger sequencing in primary human hepatocytes expressing via lentivirus Cas9 and gRNAscr, with the TSS indicated by a black arrow and the reference protein sequence in red. CGs are bolded and underlined. Below is the dominant Sanger sequence profile of a primary human hepatocyte population expressing lentiviral Cas9 and gRNAHNF4A. This mutation and the resulting difference in the amino acid sequence, as well as the reference sequences at this location, are highlighted in yellow. b Two technical replicates each of the Sanger sequencing chromatograms from the primary human hepatocytes expressing dCas9 and gRNAscr (left) or dCas9 and gRNAHNF4A (right) at the targeted HNF4A locus. c Sanger sequencing results of 13 gRNAscr and 12 gRNAHNF4A DNA strands following bisulfite conversion from the cell populations in ( b ), demonstrating both the methylation levels and the variety of mutations induced by Cas9 in gHNF4A-treated cells. d Same as ( c ) except data expanded is expanded to a larger (>300 bp) region, and simplified such that only CpGs are shown, where blue squares indicate unmethylated CpGs, red squares indicate methylated CpGs, and white squares indicate missing information due to Cas9-induced deletions. CpGs are numbered in accordance with ( a ). e Bisulfite-sequencing data from ( d ) (center) as well as five CpGs immediately upstream (left) and seven CpGs immediately downstream (right), displayed as percent DNA methylation over all sequenced DNA strands in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) and as mean ± SD as it is summary data from one mutated cell line. Individual dots represent individual strands of DNA from this clonal cell line. f HNF4A expression in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) quantified by RT-qPCR and normalized to GAPDH expression, followed by normalization to average expression in gRNAscr cells, with a dashed line at 1 ( n = 6 independent clones, mean ± SD). * indicates statistically significant difference of P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, and ns not significant (Student’s t -test, two-sided, with Holm-Sidak correction if number of tests is greater than 3). Source data are provided as a Source Data file.
Grna Target Sequence Predictor Tool, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pmc07857428-131-1-9?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
grna target sequence predictor tool - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation mouse non-targeting grna (guide rna) sequence
a The sequence of the lentiviral gRNAHNF4A and its PAM site in blue. Above is the reference sequence of the <t>HNF4A</t> gene near the gRNA target site, as validated by Sanger sequencing in primary human hepatocytes expressing via lentivirus Cas9 and gRNAscr, with the TSS indicated by a black arrow and the reference protein sequence in red. CGs are bolded and underlined. Below is the dominant Sanger sequence profile of a primary human hepatocyte population expressing lentiviral Cas9 and gRNAHNF4A. This mutation and the resulting difference in the amino acid sequence, as well as the reference sequences at this location, are highlighted in yellow. b Two technical replicates each of the Sanger sequencing chromatograms from the primary human hepatocytes expressing dCas9 and gRNAscr (left) or dCas9 and gRNAHNF4A (right) at the targeted HNF4A locus. c Sanger sequencing results of 13 gRNAscr and 12 gRNAHNF4A DNA strands following bisulfite conversion from the cell populations in ( b ), demonstrating both the methylation levels and the variety of mutations induced by Cas9 in gHNF4A-treated cells. d Same as ( c ) except data expanded is expanded to a larger (>300 bp) region, and simplified such that only CpGs are shown, where blue squares indicate unmethylated CpGs, red squares indicate methylated CpGs, and white squares indicate missing information due to Cas9-induced deletions. CpGs are numbered in accordance with ( a ). e Bisulfite-sequencing data from ( d ) (center) as well as five CpGs immediately upstream (left) and seven CpGs immediately downstream (right), displayed as percent DNA methylation over all sequenced DNA strands in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) and as mean ± SD as it is summary data from one mutated cell line. Individual dots represent individual strands of DNA from this clonal cell line. f HNF4A expression in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) quantified by RT-qPCR and normalized to GAPDH expression, followed by normalization to average expression in gRNAscr cells, with a dashed line at 1 ( n = 6 independent clones, mean ± SD). * indicates statistically significant difference of P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, and ns not significant (Student’s t -test, two-sided, with Holm-Sidak correction if number of tests is greater than 3). Source data are provided as a Source Data file.
Mouse Non Targeting Grna (Guide Rna) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pm33197448-108-8-28?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
mouse non-targeting grna (guide rna) sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation gcc88 crispr guide rna (grna) plasmid (grna targeting sequence: caactggcctcttcggactt)
a The sequence of the lentiviral gRNAHNF4A and its PAM site in blue. Above is the reference sequence of the <t>HNF4A</t> gene near the gRNA target site, as validated by Sanger sequencing in primary human hepatocytes expressing via lentivirus Cas9 and gRNAscr, with the TSS indicated by a black arrow and the reference protein sequence in red. CGs are bolded and underlined. Below is the dominant Sanger sequence profile of a primary human hepatocyte population expressing lentiviral Cas9 and gRNAHNF4A. This mutation and the resulting difference in the amino acid sequence, as well as the reference sequences at this location, are highlighted in yellow. b Two technical replicates each of the Sanger sequencing chromatograms from the primary human hepatocytes expressing dCas9 and gRNAscr (left) or dCas9 and gRNAHNF4A (right) at the targeted HNF4A locus. c Sanger sequencing results of 13 gRNAscr and 12 gRNAHNF4A DNA strands following bisulfite conversion from the cell populations in ( b ), demonstrating both the methylation levels and the variety of mutations induced by Cas9 in gHNF4A-treated cells. d Same as ( c ) except data expanded is expanded to a larger (>300 bp) region, and simplified such that only CpGs are shown, where blue squares indicate unmethylated CpGs, red squares indicate methylated CpGs, and white squares indicate missing information due to Cas9-induced deletions. CpGs are numbered in accordance with ( a ). e Bisulfite-sequencing data from ( d ) (center) as well as five CpGs immediately upstream (left) and seven CpGs immediately downstream (right), displayed as percent DNA methylation over all sequenced DNA strands in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) and as mean ± SD as it is summary data from one mutated cell line. Individual dots represent individual strands of DNA from this clonal cell line. f HNF4A expression in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) quantified by RT-qPCR and normalized to GAPDH expression, followed by normalization to average expression in gRNAscr cells, with a dashed line at 1 ( n = 6 independent clones, mean ± SD). * indicates statistically significant difference of P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, and ns not significant (Student’s t -test, two-sided, with Holm-Sidak correction if number of tests is greater than 3). Source data are provided as a Source Data file.
Gcc88 Crispr Guide Rna (Grna) Plasmid (Grna Targeting Sequence: Caactggcctcttcggactt), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+target+sequences/pm30791178-23-1-14?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
gcc88 crispr guide rna (grna) plasmid (grna targeting sequence: caactggcctcttcggactt) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Screening effective gRNA target sites for cyclin T1 editing: HeLa cells were transfected with pLentiCRISPR-gRNA-1, pLentiCRISPR-gRNA-2, or pLentiCRISPR-gRNA-3 using lipofectamine 2000 as described in methods Our previously reported lentiviral vector pHIV-7-GFP was transfected as control. , 8 days post-transfection, total protein was isolated and analyzed for cyclin T1 protein levels using western blot analyses. pLentiCRISPR-gRNA-2 demonstrates maximal cyclin T1 suppression (A). HIV-infected HeLa-CD4 cells were transfected with pLentiCRISPR-gRNA-1, pLentiCRISPR-gRNA-2, or pLentiCRISPR-gRNA-3. At designated time points, culture supernatants were collected and analyzed for HIV p24. All three gRNAs demonstrate HIV suppression, with pLentiCRISPR-gRNA-2 demonstrating maximal suppression at both time points (B). Cells were trypsinized, followed by trypsin neutralization buffer. Cells were washed to remove trypsin and resuspended in DMEM 10% FBS. The otal number of live cells and percentage of viability were determined by trypan blue staining as described in . Cyclin T1 knockdown does not affect the percentage of cell viability. However, we observed a statistically significant decline in the number of live cells with all pLentiCRISPR-gRNAs, including our most efficient pLentiCRISPR-gRNA-2 (C). n = mean ± SEM from 3 independent experiments. ∗, significant from control; S, significant from each other (p < 0.05).

Journal: Molecular Therapy. Nucleic Acids

Article Title: A conditional RNA Pol II mono-promoter drives HIV-inducible, CRISPR-mediated cyclin T1 suppression and HIV inhibition

doi: 10.1016/j.omtn.2023.04.011

Figure Lengend Snippet: Screening effective gRNA target sites for cyclin T1 editing: HeLa cells were transfected with pLentiCRISPR-gRNA-1, pLentiCRISPR-gRNA-2, or pLentiCRISPR-gRNA-3 using lipofectamine 2000 as described in methods Our previously reported lentiviral vector pHIV-7-GFP was transfected as control. , 8 days post-transfection, total protein was isolated and analyzed for cyclin T1 protein levels using western blot analyses. pLentiCRISPR-gRNA-2 demonstrates maximal cyclin T1 suppression (A). HIV-infected HeLa-CD4 cells were transfected with pLentiCRISPR-gRNA-1, pLentiCRISPR-gRNA-2, or pLentiCRISPR-gRNA-3. At designated time points, culture supernatants were collected and analyzed for HIV p24. All three gRNAs demonstrate HIV suppression, with pLentiCRISPR-gRNA-2 demonstrating maximal suppression at both time points (B). Cells were trypsinized, followed by trypsin neutralization buffer. Cells were washed to remove trypsin and resuspended in DMEM 10% FBS. The otal number of live cells and percentage of viability were determined by trypan blue staining as described in . Cyclin T1 knockdown does not affect the percentage of cell viability. However, we observed a statistically significant decline in the number of live cells with all pLentiCRISPR-gRNAs, including our most efficient pLentiCRISPR-gRNA-2 (C). n = mean ± SEM from 3 independent experiments. ∗, significant from control; S, significant from each other (p < 0.05).

Article Snippet: Three gRNA sequences targeting cyclin T1 were obtained from Genscript ( https://www.genscript.com/gRNA-detail/904/CCNT1-CRISPR-guide-RNA.html ).

Techniques: Transfection, Plasmid Preparation, Control, Isolation, Western Blot, Infection, Neutralization, Staining, Knockdown

HIV LTR-hsp70 fusion promoter demonstrates HIV-inducible co-expression of cyclin T1-targeting gRNA and Cas9 (A) Schematic of LTRhsp-CRISPR cassette (not drawn to scale): in presence of HIV Tat, P-TEFb kinase is recruited to the HIV LTR-minimal Drosophila hsp70 fusion promoter, inducing transcription from both promoters. Most of the transcription from the minimal hsp70 promoter will terminate at the minimal polyA to express the cyclin T1-targeting gRNA-2, while transcriptional readthrough will encode the Cas9. The strong eukaryotic translation initiation signal CCACC ensures that the first ATG after this sequence is used for translation initiation. Given the critical importance of cyclin T1 for P-TEFb recruitment by HIV Tat, inactivation of cyclin T1 will irreversibly block all transcription from HIV locking it in a transcriptionally inactive state. Since the fusion promoter also requires Tat-cyclin T1 interaction for co-expression of cyclin T1 gRNA and Cas9, once cyclin T1 is knocked down, transcription from both the HIV proviral DNA as well as the fusion promoter will be completely inhibited, possibly affecting a functional cure and limiting any further expression from the fusion promoter. (B) Uninfected HeLa-CD4 cells or HIV-infected HeLa-CD4 cells were transfected with LTRhsp-CRISPR or the NF-κB or SP1 deletion mutants, (LTRhsp(ΔNF-κB)-CRISPR or LTRhsp(ΔSP1)-CRISPR respectively). 72 h post-transfection, total protein was isolated and analyzed for Cas9 expression by western blot analyses. HIV LTR-hsp70 fusion promoter demonstrates Cas9 expression only in HIV-infected HeLa-CD4 cells and not in uninfected HeLa-CD4 cells, demonstrating HIV-inducible expression. No expression of Cas9 is observed in LTRhsp(ΔNF-κB)-CRISPR-transfected uninfected or HIV-infected HeLa-CD4 cells, suggesting that NF-κB sites are important for transcription of Cas9 from the fusion promoter even in the presence of HIV Tat. Some expression is observed in uninfected HeLa-CD4 cells transfected with LTRhsp(ΔSP1)-CRISPR, suggesting that deleting the SP1 sites promotes leaky transcription from the fusion promoter. (C and D) Uninfected or HIV-infected HeLa-CD4 cells were transfected with LTRhsp-CRISPR or the constitutive pLentiCRISPR-gRNA-2. 6 days post-transfection, total protein was isolated and analyzed for cyclin T1 suppression by western blot analyses. Both LTRhsp-CRISPR and pLentiCRISPR-gRNA-2 demonstrate cyclin T1 suppression in HIV-infected HeLa-CD4 cells (C). However, only the constitutive pLentiCRISPR-gRNA-2 demonstrates cyclin T1 suppression in uninfected HeLa-CD4 cells. LTRhsp-CRISPR does not suppress cyclin T1 in uninfected HeLa-CD4 cells, demonstrating HIV-inducible cyclin T1 knockdown from our fusion promoter (D). (E) HIV-infected HeLa-CD4 cells were transfected with LTRhsp-CRISPR as described in the . Cells were washed four times to remove any residual HIV p24 and resuspended in fresh DMEM with 10% FBS. On day 6 post-infection, culture supernatants were collected and analyzed for HIV p24 by ELISA. LTRhsp-CRISPR suppresses HIV p24 in our stringent model of HIV infection. n = mean ± SEM from 3 independent experiments. ∗, significant from control (p < 0.05).

Journal: Molecular Therapy. Nucleic Acids

Article Title: A conditional RNA Pol II mono-promoter drives HIV-inducible, CRISPR-mediated cyclin T1 suppression and HIV inhibition

doi: 10.1016/j.omtn.2023.04.011

Figure Lengend Snippet: HIV LTR-hsp70 fusion promoter demonstrates HIV-inducible co-expression of cyclin T1-targeting gRNA and Cas9 (A) Schematic of LTRhsp-CRISPR cassette (not drawn to scale): in presence of HIV Tat, P-TEFb kinase is recruited to the HIV LTR-minimal Drosophila hsp70 fusion promoter, inducing transcription from both promoters. Most of the transcription from the minimal hsp70 promoter will terminate at the minimal polyA to express the cyclin T1-targeting gRNA-2, while transcriptional readthrough will encode the Cas9. The strong eukaryotic translation initiation signal CCACC ensures that the first ATG after this sequence is used for translation initiation. Given the critical importance of cyclin T1 for P-TEFb recruitment by HIV Tat, inactivation of cyclin T1 will irreversibly block all transcription from HIV locking it in a transcriptionally inactive state. Since the fusion promoter also requires Tat-cyclin T1 interaction for co-expression of cyclin T1 gRNA and Cas9, once cyclin T1 is knocked down, transcription from both the HIV proviral DNA as well as the fusion promoter will be completely inhibited, possibly affecting a functional cure and limiting any further expression from the fusion promoter. (B) Uninfected HeLa-CD4 cells or HIV-infected HeLa-CD4 cells were transfected with LTRhsp-CRISPR or the NF-κB or SP1 deletion mutants, (LTRhsp(ΔNF-κB)-CRISPR or LTRhsp(ΔSP1)-CRISPR respectively). 72 h post-transfection, total protein was isolated and analyzed for Cas9 expression by western blot analyses. HIV LTR-hsp70 fusion promoter demonstrates Cas9 expression only in HIV-infected HeLa-CD4 cells and not in uninfected HeLa-CD4 cells, demonstrating HIV-inducible expression. No expression of Cas9 is observed in LTRhsp(ΔNF-κB)-CRISPR-transfected uninfected or HIV-infected HeLa-CD4 cells, suggesting that NF-κB sites are important for transcription of Cas9 from the fusion promoter even in the presence of HIV Tat. Some expression is observed in uninfected HeLa-CD4 cells transfected with LTRhsp(ΔSP1)-CRISPR, suggesting that deleting the SP1 sites promotes leaky transcription from the fusion promoter. (C and D) Uninfected or HIV-infected HeLa-CD4 cells were transfected with LTRhsp-CRISPR or the constitutive pLentiCRISPR-gRNA-2. 6 days post-transfection, total protein was isolated and analyzed for cyclin T1 suppression by western blot analyses. Both LTRhsp-CRISPR and pLentiCRISPR-gRNA-2 demonstrate cyclin T1 suppression in HIV-infected HeLa-CD4 cells (C). However, only the constitutive pLentiCRISPR-gRNA-2 demonstrates cyclin T1 suppression in uninfected HeLa-CD4 cells. LTRhsp-CRISPR does not suppress cyclin T1 in uninfected HeLa-CD4 cells, demonstrating HIV-inducible cyclin T1 knockdown from our fusion promoter (D). (E) HIV-infected HeLa-CD4 cells were transfected with LTRhsp-CRISPR as described in the . Cells were washed four times to remove any residual HIV p24 and resuspended in fresh DMEM with 10% FBS. On day 6 post-infection, culture supernatants were collected and analyzed for HIV p24 by ELISA. LTRhsp-CRISPR suppresses HIV p24 in our stringent model of HIV infection. n = mean ± SEM from 3 independent experiments. ∗, significant from control (p < 0.05).

Article Snippet: Three gRNA sequences targeting cyclin T1 were obtained from Genscript ( https://www.genscript.com/gRNA-detail/904/CCNT1-CRISPR-guide-RNA.html ).

Techniques: Expressing, CRISPR, Sequencing, Blocking Assay, Functional Assay, Infection, Transfection, Isolation, Western Blot, Knockdown, Enzyme-linked Immunosorbent Assay, Control

Cis -cleaving minizymes improve RNA Pol II CRISPR-based HIV suppression (A) Schematic of LTRhsp-CRISPR minizyme-embedded variants. In the original clone ( <xref ref-type=Figure 2 A), co-expression of cyclin T1 gRNA and Cas9 results in cyclin T1 gRNA with a 5-methyl guanosine cap, which can export the gRNA from the nucleus to the cytoplasm. This can lead to suboptimal CRISPR-mediated knockdown of cyclin T1. Embedding a cis -acting minizyme just downstream of the transcriptional start such that it would cleave the 5′ cap will result in cap removal and retention of the gRNA in the nucleus. The weak ribozyme will ensure that part of the RNA is cleaved to remove the cap while some of the RNA retains the cap and is exported to the cytoplasm to express the Cas9 protein. (B) A schematic representation of the cis -cleaving minizyme-embedded variants and cleavage site upstream of the gRNA to remove the 5′ cap and improve RNA Pol II CRISPR efficacy. Hammerhead ribozymes can cleave any RNA as long as the ribozyme arms can hybridize with the target RNA, and the target contains an NUX triplet where N = A, G, C, or U and X = A, U, or C for optimal cleavage. LTRhsp-MzCRISPR recognizes a canonical GUC cleavage site, while LTRhsp-Mz(Wk)CRISPR recognizes a weaker non-canonical GUG cleavage site. (C and D) HIV-infected HeLa-CD4 cells were transfected with LTRhsp-MzCRISPR or LTRhsp-Mz(Wk)CRISPR. Transfection with the lentiviral backbone pHIV-7-GFP was used as control and to monitor transfection. Transfection with LTRhsp-CRISPR was used for comparison. To mimic a more physiological setting, only the transfection medium was replaced with fresh DMEM with 10% FBS. At designated time points, culture supernatants were collected and analyzed for HIV p24. Both ribozyme cis -cleaving minizyme-embedded variants demonstrate slightly improved HIV suppression compared with LTRhsp-CRISPR (C). Following 12 days of transfection, experiments were terminated, and cell viability was determined. LTRhsp-CRISPR or the minizyme-embedded LTRhsp-MzCRISPR or LTRhsp-Mz(Wk)CRISPR did not affect cell viability and demonstrated similar live cell counts. n = mean ± SEM from 3 independent experiments. ∗, significant from control; S, significant from each other (p < 0.05). " width="100%" height="100%">

Journal: Molecular Therapy. Nucleic Acids

Article Title: A conditional RNA Pol II mono-promoter drives HIV-inducible, CRISPR-mediated cyclin T1 suppression and HIV inhibition

doi: 10.1016/j.omtn.2023.04.011

Figure Lengend Snippet: Cis -cleaving minizymes improve RNA Pol II CRISPR-based HIV suppression (A) Schematic of LTRhsp-CRISPR minizyme-embedded variants. In the original clone ( Figure 2 A), co-expression of cyclin T1 gRNA and Cas9 results in cyclin T1 gRNA with a 5-methyl guanosine cap, which can export the gRNA from the nucleus to the cytoplasm. This can lead to suboptimal CRISPR-mediated knockdown of cyclin T1. Embedding a cis -acting minizyme just downstream of the transcriptional start such that it would cleave the 5′ cap will result in cap removal and retention of the gRNA in the nucleus. The weak ribozyme will ensure that part of the RNA is cleaved to remove the cap while some of the RNA retains the cap and is exported to the cytoplasm to express the Cas9 protein. (B) A schematic representation of the cis -cleaving minizyme-embedded variants and cleavage site upstream of the gRNA to remove the 5′ cap and improve RNA Pol II CRISPR efficacy. Hammerhead ribozymes can cleave any RNA as long as the ribozyme arms can hybridize with the target RNA, and the target contains an NUX triplet where N = A, G, C, or U and X = A, U, or C for optimal cleavage. LTRhsp-MzCRISPR recognizes a canonical GUC cleavage site, while LTRhsp-Mz(Wk)CRISPR recognizes a weaker non-canonical GUG cleavage site. (C and D) HIV-infected HeLa-CD4 cells were transfected with LTRhsp-MzCRISPR or LTRhsp-Mz(Wk)CRISPR. Transfection with the lentiviral backbone pHIV-7-GFP was used as control and to monitor transfection. Transfection with LTRhsp-CRISPR was used for comparison. To mimic a more physiological setting, only the transfection medium was replaced with fresh DMEM with 10% FBS. At designated time points, culture supernatants were collected and analyzed for HIV p24. Both ribozyme cis -cleaving minizyme-embedded variants demonstrate slightly improved HIV suppression compared with LTRhsp-CRISPR (C). Following 12 days of transfection, experiments were terminated, and cell viability was determined. LTRhsp-CRISPR or the minizyme-embedded LTRhsp-MzCRISPR or LTRhsp-Mz(Wk)CRISPR did not affect cell viability and demonstrated similar live cell counts. n = mean ± SEM from 3 independent experiments. ∗, significant from control; S, significant from each other (p < 0.05).

Article Snippet: Three gRNA sequences targeting cyclin T1 were obtained from Genscript ( https://www.genscript.com/gRNA-detail/904/CCNT1-CRISPR-guide-RNA.html ).

Techniques: CRISPR, Expressing, Knockdown, Infection, Transfection, Control, Comparison

HIV-inducible CRISPR systems were packaged, as lentiviral vectors demonstrate prolonged and sustained HIV suppression in T cell lines when used in combination with initial antiretroviral treatment CEM T cells were infected with HIV IIIB strain as described in methods. All CRISPR constructs including pHIV-7-GFP and the constitutive pLentiCRISPR-gRNA-2 were packaged as lentiviral vectors. (A) Cells were transduced with HIV-7-GFP or the CRISPR constructs at 100 MOI. After 24 h, medium was changed to fresh medium containing tenofovir (5 μM). 3 days post-transduction, the medium was replaced with fresh medium without tenofovir, and CEM cells were propagated in the absence of tenofovir for the remainder of the experiment. Culture supernatants were collected at the designated time points. Lentiviral vector-based delivery significantly enhances the suppressive effects of our HIV-inducible CRISPR system compared with electroporation- or transfection-based delivery. LTRhsp-CRISPR and LTRhsp-Mz(Wk)CRISPR demonstrated comparable suppression (∼90% HIV suppression) up to day 24. LTRhsp-MzCRISPR-transduced cells demonstrated the best suppression, with viral titers becoming undetectable by day 12 and remaining undetectable until day 21. The constitutively expressed LentiCRISPR-gRNA-2 demonstrated undetectable HIV on days 21 and 24. However, this was most likely due to extensive cell death in this group (B). LTRhsp-CRISPR and LTRhsp-MzCRISPR improved cell viability over controls. However, they demonstrated some decrease in the number of live cells. n = mean ± SEM from 3 independent experiments. ∗, significant from control; ∗∗, significant from pHIV-7-GFP + tenofovir; S, significant from all other CRISPR constructs; ND, not detectable (p < 0.05).

Journal: Molecular Therapy. Nucleic Acids

Article Title: A conditional RNA Pol II mono-promoter drives HIV-inducible, CRISPR-mediated cyclin T1 suppression and HIV inhibition

doi: 10.1016/j.omtn.2023.04.011

Figure Lengend Snippet: HIV-inducible CRISPR systems were packaged, as lentiviral vectors demonstrate prolonged and sustained HIV suppression in T cell lines when used in combination with initial antiretroviral treatment CEM T cells were infected with HIV IIIB strain as described in methods. All CRISPR constructs including pHIV-7-GFP and the constitutive pLentiCRISPR-gRNA-2 were packaged as lentiviral vectors. (A) Cells were transduced with HIV-7-GFP or the CRISPR constructs at 100 MOI. After 24 h, medium was changed to fresh medium containing tenofovir (5 μM). 3 days post-transduction, the medium was replaced with fresh medium without tenofovir, and CEM cells were propagated in the absence of tenofovir for the remainder of the experiment. Culture supernatants were collected at the designated time points. Lentiviral vector-based delivery significantly enhances the suppressive effects of our HIV-inducible CRISPR system compared with electroporation- or transfection-based delivery. LTRhsp-CRISPR and LTRhsp-Mz(Wk)CRISPR demonstrated comparable suppression (∼90% HIV suppression) up to day 24. LTRhsp-MzCRISPR-transduced cells demonstrated the best suppression, with viral titers becoming undetectable by day 12 and remaining undetectable until day 21. The constitutively expressed LentiCRISPR-gRNA-2 demonstrated undetectable HIV on days 21 and 24. However, this was most likely due to extensive cell death in this group (B). LTRhsp-CRISPR and LTRhsp-MzCRISPR improved cell viability over controls. However, they demonstrated some decrease in the number of live cells. n = mean ± SEM from 3 independent experiments. ∗, significant from control; ∗∗, significant from pHIV-7-GFP + tenofovir; S, significant from all other CRISPR constructs; ND, not detectable (p < 0.05).

Article Snippet: Three gRNA sequences targeting cyclin T1 were obtained from Genscript ( https://www.genscript.com/gRNA-detail/904/CCNT1-CRISPR-guide-RNA.html ).

Techniques: CRISPR, Infection, Construct, Transduction, Plasmid Preparation, Electroporation, Transfection, Control

Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: CRISPR, SDS Page, Two Tailed Test, Fluorescence, Western Blot, Expressing

SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: SDS Page, Transfection, Construct, Two Tailed Test

High throughput measurement of repair outcomes. Constructs containing both a gRNA and its target sequence (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).

Journal: bioRxiv

Article Title: Mutations generated by repair of Cas9-induced double strand breaks are predictable from surrounding sequence

doi: 10.1101/400341

Figure Lengend Snippet: High throughput measurement of repair outcomes. Constructs containing both a gRNA and its target sequence (matched colors) in variable context (grey boxes) are cloned en masse into target vectors containing a human U6 promoter (green) (1), packaged into lentiviral particles, and used to infect cells (2), where they generate mutations at the target (3). DNA from the cells is extracted, the target sequence in its context amplified with common primers, and the repair outcomes determined by deep short read sequencing (4).

Article Snippet: Library cloning started by PCR amplification of the 170 nt oligonucleotide pool of designed sequences (CustomArray) encoding gRNA and target sequence, separated by a spacer harbouring two BbsI restriction sites (Supplementary ).

Techniques: High Throughput Screening Assay, Construct, Sequencing, Clone Assay, Amplification

A.Example measured repair profile reproducibility of one gRNA-target pair. DNA sequence of the target (top) is edited to produce a range of outcomes in two synthetic replicates (green, blue bars) and one endogenous measurement (orange bars). The proportions (x-axis) of the four most frequent mutational outcomes (e.g. “D3” - deletion of three base pairs, “I1” - insertion of one base pair, etc.; y-axis) is consistent between the experiments. Stretches of microhomology (green) and inserted sequences (red) are highlighted at the cut site (dashed vertical line). B.Synthetic measurements faithfully capture endogenous outcomes. Symmetrized Kullback-Leibler divergence (white to black color scale) between the measured repair profiles (e.g. ) in our synthetic measurements in K562 cells (x-axis) when compared to the same individual gRNAs in endogenous measurements from van Overbeek et al. (y-axis). C.Synthetic measurements are reproducible and gRNA-specific. Box plots (orange median line, quartiles for box edges, 95% whiskers) of symmetrised KL divergences between replicate measurements of over 6000 gRNAs (left), as well as two different sets of randomly selected gRNA pairs (middle, right) using the same library of constructs (green boxes) and a separately cloned library of corresponding constructs (blue boxes). D.Frame information is reproducible between replicates, and well correlated with endogenous outcomes. In-frame percentages for one biological replicate of our synthetic measurements (y-axis) contrasted against another replicate (x-axis, blue markers, Pearson’s R=0.895), or endogenous measurements (x-axis, orange markers, Pearson’s R=0.78). E.Low coverage and large deletions are the main sources of discrepancy between endogenous and synthetic measurements. Symmetrized KL divergence (y-axis) between endogenous and synthetic measurements of the same gRNA editing outcomes (individual markers) is dependent on the sequencing coverage (log 10 (number of obtained reads), x-axis), and frequency of very large deletions (colors). Three target sequences that frequently give rise to very large deletions (red, purple) are not well captured by our assay by design.

Journal: bioRxiv

Article Title: Mutations generated by repair of Cas9-induced double strand breaks are predictable from surrounding sequence

doi: 10.1101/400341

Figure Lengend Snippet: A.Example measured repair profile reproducibility of one gRNA-target pair. DNA sequence of the target (top) is edited to produce a range of outcomes in two synthetic replicates (green, blue bars) and one endogenous measurement (orange bars). The proportions (x-axis) of the four most frequent mutational outcomes (e.g. “D3” - deletion of three base pairs, “I1” - insertion of one base pair, etc.; y-axis) is consistent between the experiments. Stretches of microhomology (green) and inserted sequences (red) are highlighted at the cut site (dashed vertical line). B.Synthetic measurements faithfully capture endogenous outcomes. Symmetrized Kullback-Leibler divergence (white to black color scale) between the measured repair profiles (e.g. ) in our synthetic measurements in K562 cells (x-axis) when compared to the same individual gRNAs in endogenous measurements from van Overbeek et al. (y-axis). C.Synthetic measurements are reproducible and gRNA-specific. Box plots (orange median line, quartiles for box edges, 95% whiskers) of symmetrised KL divergences between replicate measurements of over 6000 gRNAs (left), as well as two different sets of randomly selected gRNA pairs (middle, right) using the same library of constructs (green boxes) and a separately cloned library of corresponding constructs (blue boxes). D.Frame information is reproducible between replicates, and well correlated with endogenous outcomes. In-frame percentages for one biological replicate of our synthetic measurements (y-axis) contrasted against another replicate (x-axis, blue markers, Pearson’s R=0.895), or endogenous measurements (x-axis, orange markers, Pearson’s R=0.78). E.Low coverage and large deletions are the main sources of discrepancy between endogenous and synthetic measurements. Symmetrized KL divergence (y-axis) between endogenous and synthetic measurements of the same gRNA editing outcomes (individual markers) is dependent on the sequencing coverage (log 10 (number of obtained reads), x-axis), and frequency of very large deletions (colors). Three target sequences that frequently give rise to very large deletions (red, purple) are not well captured by our assay by design.

Article Snippet: Library cloning started by PCR amplification of the 170 nt oligonucleotide pool of designed sequences (CustomArray) encoding gRNA and target sequence, separated by a spacer harbouring two BbsI restriction sites (Supplementary ).

Techniques: Sequencing, Construct, Clone Assay

A.Single base insertions are most common, with a long tail of moderately long deletions. The frequency (y-axis) of deletion or insertion size (x-axis), averaged across genomic sequence targets. B.Editing outcome types are diverse. The average percent occurrence (area of wedge) of small (<4nt) and large (≥4nt) deletions, both microhomology-mediated and not, as well as small (1nt) and large (>1nt) insertions, measured in K562 cells, and averaged across genomic sequence targets. C.Per-gRNA event frequencies differ across indel classes. Number of individual indels (y-axis) as a percentage of all mutations observed for their gRNA (x-axis) separated by mutations class (rows). Colors as in (B). D.Specific single insertions and microhomology-mediated deletions are the most frequent reproducible mutation classes. The percent of gRNAs (area of wedge) that have the same specific indel as their most frequent mutation in all three replicates, stratified by indel class (colors). ‘No consensus’: inconsistent most frequent mutation across replicates. E.A single allele often accounts for a large fraction of editing outcomes for a gRNA. Number of gRNAs (y-axis) with the frequency of its most common outcome (x-axis) in K562 cells. F.A small number of outcomes explains most of the observed data, but many low frequency alleles are present. Cumulative fraction of observed data (y-axis) matching an increasing number of outcomes (x-axis) for each target in K562 cells (grey lines), and their average (blue line).

Journal: bioRxiv

Article Title: Mutations generated by repair of Cas9-induced double strand breaks are predictable from surrounding sequence

doi: 10.1101/400341

Figure Lengend Snippet: A.Single base insertions are most common, with a long tail of moderately long deletions. The frequency (y-axis) of deletion or insertion size (x-axis), averaged across genomic sequence targets. B.Editing outcome types are diverse. The average percent occurrence (area of wedge) of small (<4nt) and large (≥4nt) deletions, both microhomology-mediated and not, as well as small (1nt) and large (>1nt) insertions, measured in K562 cells, and averaged across genomic sequence targets. C.Per-gRNA event frequencies differ across indel classes. Number of individual indels (y-axis) as a percentage of all mutations observed for their gRNA (x-axis) separated by mutations class (rows). Colors as in (B). D.Specific single insertions and microhomology-mediated deletions are the most frequent reproducible mutation classes. The percent of gRNAs (area of wedge) that have the same specific indel as their most frequent mutation in all three replicates, stratified by indel class (colors). ‘No consensus’: inconsistent most frequent mutation across replicates. E.A single allele often accounts for a large fraction of editing outcomes for a gRNA. Number of gRNAs (y-axis) with the frequency of its most common outcome (x-axis) in K562 cells. F.A small number of outcomes explains most of the observed data, but many low frequency alleles are present. Cumulative fraction of observed data (y-axis) matching an increasing number of outcomes (x-axis) for each target in K562 cells (grey lines), and their average (blue line).

Article Snippet: Library cloning started by PCR amplification of the 170 nt oligonucleotide pool of designed sequences (CustomArray) encoding gRNA and target sequence, separated by a spacer harbouring two BbsI restriction sites (Supplementary ).

Techniques: Sequencing, Mutagenesis

A.Nearby matching sequences are used as substrate for microhomology-mediated repair more frequently than distant ones. Fraction of mutated reads (y-axis) for increasing distance between matching sequences of length 9 (x-axis) for individual targets (blue markers) in K562 cells, and a linear regression fit to the trend (solid line). B.Frequency of microhomology-mediated repair depends on the length of and distance between the matching sequences. Same as (A), but linear regression fits only for microhomologies of lengths 3 (gray, bottom) to 15 (yellow, top), with Pearson’s correlation noted in the legend. C.GC content influences microhomology-mediated repair fidelity. Percent gRNA reads with length 9 microhomology-mediated deletion (y-axis; boxes median and quartiles, whiskers 5% and 95%) across a range of GC contents (x-axis). D.Mutations in microhomology sequence reduce repair outcome frequency, but corresponding deletions are still present. For matched pairs of gRNAs, with and without mutations in the microhomologous sequence, the fraction of mutated reads associated with the particular microhomology with mismatches (y-axis) vs without mismatches (x-axis) (markers; blue: one mismatch, yellow: two mismatches; solid lines: linear regression fits). Dashed black line: y=x. E.The sequence context at the cut site influences which single base is inserted. PAM-distal (blue), PAM-proximal (green), and other (red) nucleotide insertion frequency of all single base insertions; if proximal and distal bases are identical (orange), no call can be made. F.Single base insertion rate depends on the PAM-distal base adjacent to the cut site. The average percent of per-gRNA mutations that are unambiguous PAM-distal 1bp insertions (y-axis), stratified by the PAM-distal nucleotide (x-axis).

Journal: bioRxiv

Article Title: Mutations generated by repair of Cas9-induced double strand breaks are predictable from surrounding sequence

doi: 10.1101/400341

Figure Lengend Snippet: A.Nearby matching sequences are used as substrate for microhomology-mediated repair more frequently than distant ones. Fraction of mutated reads (y-axis) for increasing distance between matching sequences of length 9 (x-axis) for individual targets (blue markers) in K562 cells, and a linear regression fit to the trend (solid line). B.Frequency of microhomology-mediated repair depends on the length of and distance between the matching sequences. Same as (A), but linear regression fits only for microhomologies of lengths 3 (gray, bottom) to 15 (yellow, top), with Pearson’s correlation noted in the legend. C.GC content influences microhomology-mediated repair fidelity. Percent gRNA reads with length 9 microhomology-mediated deletion (y-axis; boxes median and quartiles, whiskers 5% and 95%) across a range of GC contents (x-axis). D.Mutations in microhomology sequence reduce repair outcome frequency, but corresponding deletions are still present. For matched pairs of gRNAs, with and without mutations in the microhomologous sequence, the fraction of mutated reads associated with the particular microhomology with mismatches (y-axis) vs without mismatches (x-axis) (markers; blue: one mismatch, yellow: two mismatches; solid lines: linear regression fits). Dashed black line: y=x. E.The sequence context at the cut site influences which single base is inserted. PAM-distal (blue), PAM-proximal (green), and other (red) nucleotide insertion frequency of all single base insertions; if proximal and distal bases are identical (orange), no call can be made. F.Single base insertion rate depends on the PAM-distal base adjacent to the cut site. The average percent of per-gRNA mutations that are unambiguous PAM-distal 1bp insertions (y-axis), stratified by the PAM-distal nucleotide (x-axis).

Article Snippet: Library cloning started by PCR amplification of the 170 nt oligonucleotide pool of designed sequences (CustomArray) encoding gRNA and target sequence, separated by a spacer harbouring two BbsI restriction sites (Supplementary ).

Techniques: Sequencing

a The sequence of the lentiviral gRNAHNF4A and its PAM site in blue. Above is the reference sequence of the HNF4A gene near the gRNA target site, as validated by Sanger sequencing in primary human hepatocytes expressing via lentivirus Cas9 and gRNAscr, with the TSS indicated by a black arrow and the reference protein sequence in red. CGs are bolded and underlined. Below is the dominant Sanger sequence profile of a primary human hepatocyte population expressing lentiviral Cas9 and gRNAHNF4A. This mutation and the resulting difference in the amino acid sequence, as well as the reference sequences at this location, are highlighted in yellow. b Two technical replicates each of the Sanger sequencing chromatograms from the primary human hepatocytes expressing dCas9 and gRNAscr (left) or dCas9 and gRNAHNF4A (right) at the targeted HNF4A locus. c Sanger sequencing results of 13 gRNAscr and 12 gRNAHNF4A DNA strands following bisulfite conversion from the cell populations in ( b ), demonstrating both the methylation levels and the variety of mutations induced by Cas9 in gHNF4A-treated cells. d Same as ( c ) except data expanded is expanded to a larger (>300 bp) region, and simplified such that only CpGs are shown, where blue squares indicate unmethylated CpGs, red squares indicate methylated CpGs, and white squares indicate missing information due to Cas9-induced deletions. CpGs are numbered in accordance with ( a ). e Bisulfite-sequencing data from ( d ) (center) as well as five CpGs immediately upstream (left) and seven CpGs immediately downstream (right), displayed as percent DNA methylation over all sequenced DNA strands in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) and as mean ± SD as it is summary data from one mutated cell line. Individual dots represent individual strands of DNA from this clonal cell line. f HNF4A expression in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) quantified by RT-qPCR and normalized to GAPDH expression, followed by normalization to average expression in gRNAscr cells, with a dashed line at 1 ( n = 6 independent clones, mean ± SD). * indicates statistically significant difference of P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, and ns not significant (Student’s t -test, two-sided, with Holm-Sidak correction if number of tests is greater than 3). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Unraveling the functional role of DNA demethylation at specific promoters by targeted steric blockage of DNA methyltransferase with CRISPR/dCas9

doi: 10.1038/s41467-021-25991-9

Figure Lengend Snippet: a The sequence of the lentiviral gRNAHNF4A and its PAM site in blue. Above is the reference sequence of the HNF4A gene near the gRNA target site, as validated by Sanger sequencing in primary human hepatocytes expressing via lentivirus Cas9 and gRNAscr, with the TSS indicated by a black arrow and the reference protein sequence in red. CGs are bolded and underlined. Below is the dominant Sanger sequence profile of a primary human hepatocyte population expressing lentiviral Cas9 and gRNAHNF4A. This mutation and the resulting difference in the amino acid sequence, as well as the reference sequences at this location, are highlighted in yellow. b Two technical replicates each of the Sanger sequencing chromatograms from the primary human hepatocytes expressing dCas9 and gRNAscr (left) or dCas9 and gRNAHNF4A (right) at the targeted HNF4A locus. c Sanger sequencing results of 13 gRNAscr and 12 gRNAHNF4A DNA strands following bisulfite conversion from the cell populations in ( b ), demonstrating both the methylation levels and the variety of mutations induced by Cas9 in gHNF4A-treated cells. d Same as ( c ) except data expanded is expanded to a larger (>300 bp) region, and simplified such that only CpGs are shown, where blue squares indicate unmethylated CpGs, red squares indicate methylated CpGs, and white squares indicate missing information due to Cas9-induced deletions. CpGs are numbered in accordance with ( a ). e Bisulfite-sequencing data from ( d ) (center) as well as five CpGs immediately upstream (left) and seven CpGs immediately downstream (right), displayed as percent DNA methylation over all sequenced DNA strands in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) and as mean ± SD as it is summary data from one mutated cell line. Individual dots represent individual strands of DNA from this clonal cell line. f HNF4A expression in primary human hepatocytes expressing Cas9 and either gRNAscr (gray) or gRNAHNF4A (orange) quantified by RT-qPCR and normalized to GAPDH expression, followed by normalization to average expression in gRNAscr cells, with a dashed line at 1 ( n = 6 independent clones, mean ± SD). * indicates statistically significant difference of P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, and ns not significant (Student’s t -test, two-sided, with Holm-Sidak correction if number of tests is greater than 3). Source data are provided as a Source Data file.

Article Snippet: The HNF4A -targeting gRNA is from the genome-scale CRISPR knock-out (GeCKO) v2 library (purchased as lentiviral plasmid from Genscript) and the FMR1-targeting gRNA from the Jaenisch lab was obtained from Addgene (pgRNA-CGG, Addgene #108248).

Techniques: Sequencing, Expressing, Mutagenesis, Methylation, Methylation Sequencing, DNA Methylation Assay, Quantitative RT-PCR, Clone Assay